BI101J, UNSEEN LIFE ON EARTH, QUIZ 4 Evaluate this statement: The really tough thing for microbiologists to accomplish in research is the discovery and description of new species. False; most discoveries now are centered on the nature of the prokaryote nucleus. * False; new DNA techniques have shown that only a small minority of microbes has been described! Most anywhere you look, new bugs can be found. Most of these new bugs cannot be grown in the lab. True; most genetic analyses performed show little differences among microbes. True; most of the world’s environments have been exhaustively examined for microbes. none of the above Evaluate this statement: Microbes found in different environments will most likely have different genomes. False; there is no relationship between habitat and genome. True; different amino acid sequences on the genes of different bugs will be present. * True; genes produce the enzymes that allow bugs to thrive and reproduce; different habitats will thus require that different genetic material is present. none of the above Differences in genes can be a measure of the likelihood that microorganisms have similar mitochondria. the probability that the bacteria have a cell wall or not. * the time since organisms shared a common ancestor; this is called the “genetic distance,” and can be used to create a family tree. all of the above How is genetic distance used to create a family tree? * Organisms with more similar genetic material are assumed to be more closely related and are placed closer on a tree. The genetic material is weighed and organisms with similar weights are placed closer on the tree. The number of mutations present is an indication of the amount of mutation-causing substances in the environment. all of the above none of the above What important change occurred in the biosphere as a result of microbial metabolism? an increase in the amount of land mass * an increase in the amount of oxygen from nearly undetectable to today’s level of about 20% a decrease in the amount of atmospheric oxygen an increase in the amount of atmospheric phosphorus none of the above What is meant by the assertion that certain elements cycle through the biosphere because of microbial metabolism? * Elements such as nitrogen are converted from one form to another only by microbes. Water is converted to sugars by means of microbial photosynthesis. Bacteria eat new recalcitrant macromolecules. all of the above none of the above Use the following DNA information to determine which sequence of relationship (family tree) is better. I’ve supplied a short, but sufficient segment of DNA. Species and gene sequence: species U, TATATAGCATATAATACGACGCTAGCATGCTAGTC ; species V, TATATAGCATATAAGCGCGCCGCGATGCGTCGACC; species W, TATATAGCATATAATACGACGCTAGCTACGATAAA; species X, TATATAGCAT_GCTATCGATAGCTAGCTAGTCGATT ; species Y, TATATAGCATATAATACGACGCTAGCTACGGCTAT; species Z, TATATAGCATATAATACGACGCTCGTAGCTTTTTT XVZUWY * YWXVZU What would happen if all the nitrogen-fixing bacteria were to disappear and if humans no longer used the Haber process? * Through the actions of denitrifying bacteria, all nitrogen would eventually be converted back to N2. Most life on Earth would die as a result. The problem of excess nitrogen in the environment would be much relieved. We would see the end of eutrophication. all of the above none of the above One result of our reliance on fossil fuels such as coal, oil, and natural gas is a substantial ________, and global warming is a consequence. * increase in the amount of CO2 returning to the atmosphere decrease in the amount of CO2 in the atmosphere decrease in the amount of N2 in the atmosphere increase in the amount of O2 in the atmosphere decrease in the amount of O2 in the atmosphere If a new carbon compound (such as a plastic) is invented, the bacteria begin multiplying rapidly in response to the new food supply. bacteria begin mutating rapidly in response to the new food supply. * the bonds between the carbon atoms may not be able to be broken by microbes; the recalcitrant material may take hundreds of years to break down. all of the above none of the above Which of the following would most benefit from the addition of oxygen to a nutrient-rich body of water? * aerobic bacteria anaerobic bacteria extremophiles ducks What’s the difference between infection and disease? It’s a matter of degree; if one is colonized by 50 bugs, that’s an infection; if by 5000 bugs, that’s a disease. * Someone may be colonized by a bug, but suffer no disease symptoms. They are carriers and may be capable of transmitting the bug to others, however. A pathogen causes disease; any other bug causes an infection. all of the above none of the above Why did the myxoma virus fail to control the population of rabbits in Australia? because of the lack of fleas because of the lack of mosquitoes * Natural selection killed the most sensitive rabbits and favored the least lethal viruses. none of the above How can the sickle cell trait possibly be considered beneficial? That’s an awful thing to say – it causes anemia and may be lethal! * People carrying one copy of the sickle cell trait and one copy of the non-sickle trait are resistant to malaria. People carrying one copy of the sickle-cell trait are resistant to dengue fever. People carrying one copy of the sickle-cell trait are resistant to Q fever. People carrying one copy of the sickle-cell trait are resistant to rabies. People carrying one copy of the sickle-cell trait are resistant to smallpox. Which of the following have had or are having a major impact on human societies? smallpox Yersinia pestis HIV * all of the above Mosquitoes may transmit * malaria. HIV, smallpox, rabies, Yersinia. Borrelia burgdorferi. all of the above none of the above Human defenses against pathogens include skin. sweat. tears. mucous membranes. * all of the above Macrophages are a type of virus-eating bacteria. * cells of the human immune system. a type of bacteria-eating virus. a serious pathogen of rabbits. a frequent contaminant of milk. The function of macrophages is to * recognize invader cells and consume them. protect other members of the microbial community in a biofilm. reduce bacterial biodiversity in aquatic ecosystems. reproduce and make more phages. none of the above Fevers are an effective response to infection because it is more difficult for cells to produce fixed nitrogen at the elevated temperatures. it is easier for cells to fix nitrogen at the elevated temperatures. * bacteria reproduce more slowly in the warmer temperatures and immune system cells can then detect and destroy the invaders. biofilms form more slowly at the elevated temperatures. none of the above