BI101J, UNSEEN LIFE ON EARTH—MIDTERM EXAM 2 Carl Woese intended to ________ by examining the gene for ribosomes. * reconstruct a family tree for all organisms discover new pharmaceutical drugs find a cure for ribosomiasis all of the above none of the above Why are thermophiles important in the creation of a universal tree of life? They represent an unimportant side branch. They are amazingly similar to other eukarya. * They represent a life form that exists now in conditions very similar to those when life first emerged on Earth. all of the above none of the above Taq polymerase is an example of a(n) ________, and is important for its key role in ________ technology. simple molecule; cell-cell communication enzyme useful in photosynthesis; telecommunications * extremozyme; PCR all of the above none of the above Humans occupy which branch on the tree of life? * eukarya archaea prokarya all of the above none of the above Some organelles, such as the ________ , have their own ________. cell wall and membrane; DNA flagella and nucleosome; enzymes * mitochondria and chloroplast; DNA all of the above none of the above The characteristics listed in the question above suggest that these organelles were once _________ bacteria. photosynthetic or energy-producing independent free-living * all of the above none of the above Horizontal gene transfer is commonly found only among eukaryotic organisms. * one reason why apparently unrelated bacteria share some genes. rare in bacteria. all of the above none of the above Pathogenic bacteria rely on _______ to gain entry to the inside of a human cell. * cell-cell communication active transport one shouldn’t say, really all of the above none of the above Evaluate this statement: Millions of microbes may be found coexisting without harm with their human hosts. True; each of us has a large and complex community of fungi, bacteria, and protists living in and on us. True; although some populations of microbes may cause problems when they grow rapidly in response to the elimination of competitors by antibiotics. True; many of these microbes perform essential functions for us and we would not be healthy without them. * all of the above none of the above How is it that our mouths are home to bacteria that can live only in the absence of oxygen? Oxygen is consumed by our red blood cells. The mouth is normally a low oxygen environment. * Anaerobic bacteria live in crevices of our teeth and gums where little oxygen can penetrate. all of the above none of the above During bacterial conjugation, DNA is shuttled from one bacterium to another by means of a viral vector. genetic material is transferred from one dead, burst bacterium to another intact one. * genetic material is transferred though a conjugation tube from one living bacterium to another. all of the above none of the above In bacterial transformation, genetic material is transferred though a conjugation tube from one living bacterium to another. DNA is shuttled from one bacterium to another by means of a viral vector. * competent bacteria take small pieces of DNA across their cell walls and incorporate them into their own DNA. all of the above none of the above In bacterial transduction, * a virus conveys DNA from one bacterium to another. competent bacteria take small pieces of DNA across their cell walls and incorporate them into their own DNA. a transducer modulates the voltage of a bacterium. all of the above none of the above Transduction, conjugation, and transformation are three processes that are effective methods of preventing nosocomial illnesses. illuminate evolutionary relationships among the eukarya. * increase genetic diversity among bacteria by promoting the exchange of genetic material. all of the above none of the above Genetic engineering is the technology of ________, and is based on bacterial ________. * manipulating the genes of an organism; transduction, transformation, and conjugation increasing seed production; cell wall structure improving roadways; degradation of asphalt and concrete all of the above none of the above Which of the following is most likely to be responsible for the increases in nosocomial infections with antibiotic-resistant pathogens? increased numbers of patients in hospitals * horizontal gene transfer by conjugation and transformation coupled with strong natural selection the policies of health maintenance organizations all of the above none of the above You experience cold symptoms but your doctor won’t oblige your request for antibiotics. Why not? The doctor is concerned that viruses will develop resistance. * Colds are caused by viral infections; viruses are unaffected by antibiotics. Antibiotics are too expensive to be used for such low impact diseases. all of the above Earth’s first life forms were * heterotrophic anaerobic bacteria. heterotrophic aerobic bacteria. autotrophic bacteria. viruses. none of the above Active transport and diffusion are * the means bacteria use to take in substances from outside their cell walls. unimportant for living organisms. terms borrowed from the computer industry to describe the techniques used in genetic engineering. all of the above none of the above Heterotrophic organisms form their own energy-rich molecules from simple starting materials like CO2 and H2O. * absorb preformed energy-rich organic substances. are found in soil environments exclusively. all of the above none of the above Evaluate this statement: The really tough thing for microbiologists to accomplish in research is the discovery and description of new species. False; most discoveries now are centered on the nature of the prokaryote nucleus. * False; new DNA techniques have shown that only a small minority of microbes has been described! Most anywhere you look, new bugs can be found. Most of these new bugs cannot be grown in the lab. True; most genetic analyses performed show little differences among microbes. True; most of the world’s environments have been exhaustively examined for microbes. none of the above Evaluate this statement: Microbes found in different environments will most likely have different genomes. False; there is no relationship between habitat and genome. True; different amino acid sequences on the genes of different bugs will be present. * True; genes produce the enzymes that allow bugs to thrive and reproduce; different habitats will thus require that different genetic material is present. none of the above Differences in genes can be a measure of the likelihood that microorganisms have similar mitochondria. the probability that the bacteria have a cell wall or not. * the time since organisms shared a common ancestor; this is called the “genetic distance,” and can be used to create a family tree. all of the above How is genetic distance used to create a family tree? * Organisms with more similar genetic material are assumed to be more closely related and are placed closer on a tree. The genetic material is weighed and organisms with similar weights are placed closer on the tree. The number of mutations present is an indication of the amount of mutation-causing substances in the environment. all of the above none of the above What important change occurred in the biosphere as a result of microbial metabolism? an increase in the amount of land mass * an increase in the amount of oxygen from nearly undetectable to today’s level of about 20% a decrease in the amount of atmospheric oxygen an increase in the amount of atmospheric phosphorus none of the above What is meant by the assertion that certain elements cycle through the biosphere because of microbial metabolism? * Elements such as nitrogen are converted from one form to another only by microbes. Water is converted to sugars by means of microbial photosynthesis. Bacteria eat new recalcitrant macromolecules. all of the above none of the above Use the following DNA information to determine which sequence of relationship (family tree) is better. I’ve supplied a short, but sufficient segment of DNA. Person's name and gene sequence: Mark, ATATAATACGACGCTAGCATGCTAGTC; Sara, ATATAAGCGCGCCGCGATGCGTCGACC; Yvon, ATATAATACGACGCTAGCTACGATAAA; Barb, ATGCTATCGATAGCTAGCTAGTCGATT; Hank, ATATAATACGACGCTAGCTACGGCTAT; Jess, ATATAATACGACGCTCGTAGCTTTTTT. * Barb, Sara, Jess, Mark, Yvon, Hank Barb, Jess, Sara, Yvon, Mark, Hank What would happen if all the nitrogen-fixing bacteria were to disappear and if humans no longer used the Haber process? * Through the actions of denitrifying bacteria, all nitrogen would eventually be converted back to N2. Most life on Earth would die as a result. The problem of excess nitrogen in the environment would be much relieved. We would see the end of eutrophication. all of the above none of the above One result of our reliance on fossil fuels such as coal, oil, and natural gas is a substantial ________, and global warming is a consequence. * increase in the amount of CO2 returning to the atmosphere decrease in the amount of CO2 in the atmosphere decrease in the amount of N2 in the atmosphere increase in the amount of O2 in the atmosphere decrease in the amount of O2 in the atmosphere If a new carbon compound (such as a plastic) is invented, the bacteria begin multiplying rapidly in response to the new food supply. bacteria begin mutating rapidly in response to the new food supply. * the bonds between the carbon atoms may not be able to be broken by microbes; the recalcitrant material may take hundreds of years to break down. all of the above none of the above Which of the following would most benefit from the addition of oxygen to a nutrient-rich body of water? * aerobic bacteria anaerobic bacteria extremophiles ducks What’s the difference between infection and disease? It’s a matter of degree; if one is colonized by 50 bugs, that’s an infection; if by 5000 bugs, that’s a disease. * Someone may be colonized by a bug, but suffer no disease symptoms. They are carriers and may be capable of transmitting the bug to others, however. A pathogen causes disease; any other bug causes an infection. all of the above none of the above Why did the myxoma virus fail to control the population of rabbits in Australia? because of the lack of fleas because of the lack of mosquitoes * Natural selection killed the most sensitive rabbits and favored the least lethal viruses. none of the above How can the sickle cell trait possibly be considered beneficial? That’s an awful thing to say – it causes anemia and may be lethal! * People carrying one copy of the sickle cell trait and one copy of the non-sickle trait are resistant to malaria. People carrying one copy of the sickle-cell trait are resistant to dengue fever. People carrying one copy of the sickle-cell trait are resistant to Q fever. People carrying one copy of the sickle-cell trait are resistant to rabies. People carrying one copy of the sickle-cell trait are resistant to smallpox. Which of the following have had or are having a major impact on human societies? smallpox Yersinia pestis HIV * all of the above Mosquitoes may transmit * malaria. HIV, smallpox, rabies, Yersinia. Borrelia burgdorferi. all of the above none of the above Human defenses against pathogens include skin. sweat. tears. mucous membranes. * all of the above Macrophages are a type of virus-eating bacteria. * cells of the human immune system. a type of bacteria-eating virus. a serious pathogen of rabbits. a frequent contaminant of milk. The function of macrophages is to * recognize invader cells and consume them. protect other members of the microbial community in a biofilm. reduce bacterial biodiversity in aquatic ecosystems. reproduce and make more phages. none of the above Fevers are an effective response to infection because it is more difficult for cells to produce fixed nitrogen at the elevated temperatures. it is easier for cells to fix nitrogen at the elevated temperatures. biofilms form more slowly at the elevated temperatures. all of the above * none of the above Examples of virus-caused diseases include the common cold. smallpox. mononucleosis. polio. * all of the above Viruses contain * DNA or RNA, but not both. mitochondria. a nucleus. a cell wall. all of the above Molds are characterized by ________, while yeasts are typically ________. the production of a good odor; produce no odor their pathogenic nature; non-pathogenic * filamentous hyphae; round or oval cells all of the above none of the above The relationship between the myxoma virus and rabbits in Australia may be described by the word or phrase: * coevolutionary. very surprising. unusual. friendly. a windfall. Diseases such as Ebola probably ________ have a widespread distribution any time soon, because ________. will; they kill most hosts before the virus has a chance to spread * won’t; they kill most hosts before the virus has a chance to spread will; they colonize the host and become infectious long before causing a disease won’t; they colonize the host and become infectious long before causing a disease none of the above There are no pathogenic eukaryotes. True * False There are no pathogenic prokaryotes. True * False All prokaryotes are pathogenic. True * False Widespread HIV infection has severely impacted the economic development of many African countries. * True False Frequent mutations are one trick of viruses to evade our immune system defenses. * True False